热门关键字:  生物  基因  细胞  动物  蛋白

siRNA用户手册

From:绿谷生物网 Updated:2006-08-18
The siRNA user guide  (revised May 6, 2004)

Selection of siRNA duplexes from the target mRNA sequence

Using Drosophila melanogaster lysates (Tuschl et al. 1999), we have systematically analyzed the silencing efficiency of siRNA duplexes as a function of the length of the siRNAs, the length of the overhang and the sequence in the overhang (Elbashir et al. 2001c). The most efficient silencing was obtained with siRNA duplexes composed of 21-nt sense and 21-nt antisense strands, paired in a manner to have a 2-nt 3' overhang. The sequence of the 2-nt 3' overhang makes a small contribution to the specificity of target recognition restricted to the unpaired nucleotide adjacent to the first base pair. 2'-Deoxynucleotides in the 3' overhangs are as efficient as ribonucleotides, but are often cheaper to synthesize and probably more nuclease resistant. We used to select siRNA sequences with TT in the overhang.

The targeted region is selected from a given cDNA sequence beginning 50 to 100 nt downstream of the start codon. Initially, 5' or 3' UTRs and regions nearby the start codon were avoided assuming that UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNP or RISC endonuclease complex. More recently, however, we have targeted 3'-UTRs and have not experienced any problems in knocking down the targeted genes. In order to design a siRNA duplex, we search for the 23-nt sequence motif AA(N19)TT (N, any nucleotide) and select hits with approx. 50% G/C-content (30% to 70% has also worked in our hands). If no suitable sequences are found, the search is extended using the motif NA(N21). The sequence of the sense siRNA corresponds to (N19)TT or N21 (position 3 to 23 of the 23-nt motif), respectively. In the latter case, we convert the 3' end of the sense siRNA to TT. The rationale for this sequence conversion is to generate a symmetric duplex with respect to the sequence composition of the sense and antisense 3' overhangs. The antisense siRNA is synthesized as the complement to position 1 to 21 of the 23-nt motif. Because position 1 of the 23-nt motif is not recognized sequence-specifically by the antisense siRNA, the 3'-most nucleotide residue of the antisense siRNA, can be chosen deliberately. However, the penultimate nucleotide of the antisense siRNA (complementary to position 2 of the 23-nt motif) should always be complementary to the targeted sequence. For simplifying chemical synthesis, we always use TT. Should an siRNA be expressed from pol III expression vectors, it is preferable that the first transcribed nucleotide is a purine. Upgraded selection rules suggest to bias the stability of the siRNA duplex in a manner that the 5' portion of the antisense siRNA is paired less stably to the sense siRNA than its 3' portion (Khvorova et al. 2003; Schwarz et al. 2003).

We always design siRNAs with symmetric 3' TT overhangs, believing that symmetric 3' overhangs help to ensure that the siRNPs are formed with approximately equal ratios of sense and antisense target RNA-cleaving siRNPs (Elbashir et al. 2001b; Elbashir et al. 2001c). Please note that the modification of the overhang of the sense sequence of the siRNA duplex is not expected to affect targeted mRNA recognition, as the antisense siRNA strand guides target recognition. In summary, no matter what you do to your overhangs, siRNAs should still function to a reasonable extent. However, using TT in the 3' overhang will always help your RNA synthesis company to let you know when you accidentally order a siRNA sequences 3' to 5' rather than in the recommended format of 5' to 3'. You may think this is funny, but it has happened quite a lot.

Compared to antisense or ribozyme technology, the secondary structure of the target mRNA does not appear to have a strong effect on silencing. We say that, because we have already knocked-down more than 20 genes using a single, essentially randomly chosen siRNA duplex (Harborth et al. 2001). Only 3 siRNA duplexes have been ineffective so far. In one or two other cases, we have found siRNAs to be inactive because the targeting site contained a single-nucleotide polymorphism. We were also able to knock-down two genes simultaneously (e.g. lamin A/C and NuMA) by using equal concentrations of siRNA duplexes.

We recommend to blast-search (NCBI database) the selected siRNA sequence against EST libraries to ensure that only one gene is targeted. In addition, we also recommend to knock-down your gene with two independent siRNA duplexes to control for specificity of the silencing effect. If selected siRNA duplexes do not function for silencing, please check for sequencing errors of the gene, polymorphisms, and whether your cell line is really from the expected species. Our initial studies on the specificity of target recognition by siRNA duplexes indicate that a single point mutation located in the paired region of an siRNA duplex is sufficient to abolish target mRNA degradation (Elbashir et al. 2001c). Furthermore, it is unknown if targeting of a gene by two different siRNA duplexes is more effective than using a single siRNA duplex. We think that the amount of siRNA-associating proteins is limiting for silencing rather than the target accessibility.

A siRNA search engine has recently been developed by Bingbing Yuan and Fran Lewitter in the Bioinformatics group of the Whitehead Institute for Biomedical Research. The program has a web interface and can be accessed after registration. Its use is free of charge for academic users. The program output is ranked by the degree of specificity of the predicted siRNAs. The user is able to define his own sequence search patterns and can also exclude single-nucleotide polymorphic sites from siRNA predictions. Here is a short description on how to access siRNA at Whitehead. If you experience difficulties with this first link, try the following: (1) Go to http://www.wi.mit.edu/res/res.html, (2) click onto the Biocomputing link on the left side, (3) go to the Bioinformatics pull-down link in the lower left side, and select Access siRNA, (4) register at the site and then use it for prediction of siRNAs.

Preparation of siRNA duplexes

21-Nucleotide RNAs are preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. Suppliers of RNA synthesis reagents are Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL , USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). Most conveniently, siRNAs are obtained from commercial RNA oligo synthesis suppliers, which sell RNA-synthesis products of different quality and costs. In general, 21-nt RNAs are not too difficult to synthesize and are readily provided in a quality suitable for RNAi. The following custom RNA synthesis companies are entitled to provide siRNAs with a license for target validation. A typical 0.2 µmol-scale RNA synthesis provides about 1 milligram of RNA, which is sufficient for 1000 transfection experiments using a 24-well tissue culture plate format. It should be noted that the use of siRNAs for knockdown experiments from any other sources than listed above requires a specific site license, which may be obtained by contacting MIT Technology Licensing Office or Garching Innovation.

 

Dharmacon: Dharmacon currently offers three siRNA options for the custom synthesis of siRNA oligos. (Dharmacon also offers a range of presynthesized siRNA duplexes.) Option A offers water-soluble, stable, 2'-protected RNA, which is readily deprotected in aqueous buffers after arrival. The 2'-protection ensures the RNA is not degraded before use. The pair of RNA oligos can be simultaneously 2'-deprotected and annealed in the same reaction as a further precaution against degradation. The siRNA duplex can then be readily desalted via ethanol precipitation directly from the aqueous 2'-deprotection/annealing reaction. After deprotection and annealing, the RNA pellet is in 400 µl buffer. To ethanol precipitate, adjust the solution to 0.3 M NaCl by addition of 26 µl 5 M NaCl. Finally, add 1500 µl absolute ethanol and vortex. After 1 to 2 h incubation of the sample on dry ice or at -20 °C, collect the RNA pellet by centrifugation. Remove all liquid and re-dissolve the pellet in 200-400 µl sterile water. Determine the concentration by UV spectroscopy (1 A260-unit is equivalent to 32 µg RNA) and continue with annealing (see below). It should be noted that the crude RNA products are more than 85% full-length, which makes gel-purification of siRNAs for knockdown applications unnecessary. Option B provides the RNA fully deprotected, desalted and aliquoted in 50 nanomole amounts. Re-dissolve the shipped RNA pellet in water and continue with siRNA annealing (see below). Option C provides the siRNAs as the purified duplex with a purity >97%. Re-dissolve the shipped RNA duplex pellet in water and continue directly with transfection (see below). This final option guarantees the duplex is properly formed and ready for transfection. It is also possible to order the RNA with duplexing but no purification with either Option A or Option B.

Qiagen/Xeragon siRNA: QIAGEN offers 2 options for siRNA synthesis: HPP Grade siRNA or HPLC-purified siRNA. In addition, a wide range of off-the-shelf predesigned and functionally validated siRNAs are available, as well as custom-designed siRNA. HPP Grade siRNA is synthesized using TOM amidite chemistry and is purified using a proprietary process to >90% purity. HPP Grade siRNAs are provided annealed. A large range of modifications are available with HPP Grade siRNA. Available modifications include Alexa Fluor, fluorescein, rhodamine, Cy3, and Cy5 dyes, amino linkers, thio linkers, and biotin, dabcyl, and phosphate modifications. HPLC-purified siRNAs are ion-exchange HPLC-purified and are more than 97% pure. They can be provided annealed or unannealed. Both HPP Grade and HPLC-purified siRNAs are desalted, deprotected, and ready to transfect. siRNAs are provided as a lyophilized pellet to ensure stability during delivery. The sterile buffer to suspend the siRNAs is included. siRNAs should be dissolved in buffer and heated to 90糃 for 1 minute followed by 1 hour incubation at 37 °C. This procedure will disrupt higher aggregates, which may have formed in the lyophilization process.

Proligo: Proligo, which recently acquired Genset Oligos, offers fully deprotected and desalted siRNAs delivered in dried form and ready for resuspension. The siRNAs are supplied either in single strand or duplex format and are more than 85% pure. Proligo also offers siRNAs at higher grades of purity (PAGE, RP-HPLC purification). All shipped siRNAs are systematically controlled by PAGE and certified for gene silencing applications. The protocol for siRNA annealing is posted on Proligo's website.

Ambion: Ambion has developed a transcription-based method for construction of siRNA available as The SilencerTM siRNA Construction Kit. Ambion also offers the traditional custom chemical synthesis service for siRNA, and supplies fully deprotected and desalted siRNAs, with optional PAGE purification and delivered in dry form along with RNase-free water and 5X annealing buffer. A central web-based resource for RNAi and siRNA methodologies, along with links to additional siRNA related products and services, can be found on Ambion's website.

For annealing, we incubate 20 µM single-stranded 21-nt RNAs in annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate) for 1 min at 90 °C, followed by 1 h at 37 °C. The solution can be stored frozen at -20 °C and freeze-thawed many times.

Synthetic hairpin RNAs can substitute for siRNAs duplexes (Harborth et al. 2003). We have tested a series of duplex RNAs closed with a UUCG-tetraloop on one side and a TT 2-nt 3' overhang on the other side. The base-paired segments were varied between 19 and 29 bp. The gene silencing efficiency for hairpin RNAs was only reduced if the stem was 19 bp and the loop joined the 3' end of the sense strand to the 5' end of the antisense strand. All other hairpin RNAs behaved very similar to siRNA duplexes.

Substitution of one or both strands of a siRNA duplex by 2'-deoxy or 2'-O-methyl oligoribonucleotides abolished silencing in fly extract (Elbashir et al. 2001c). In mammalian cells, however it seems possible to substitute the sense siRNA by a 2'-O-methyl oligoribonucleotide (Ge et al. 2003)

Useful siRNA reagent combinations

For linking siRNA knockdown to specific phenotypes in cultured cells, it is necessary to demonstrate the reduction of targeted protein or at least demonstrate the reduction of the targeted mRNA. Specific antibodies allow to directly monitor the reduction of targeted protein by Western blotting and to estimate the transfection efficiency using cell-based immunofluorescence analysis. To expedite such analysis, Upstate and Dharmacon have joined forces and now provide validated sets of siRNA reagents together with the corresponding target-specific antibody. They also provide siRNA starter kits that include a set of controls for the siRNA transfection and Western blot analysis.

Transfection of siRNA duplexes

We perform a single transfection of siRNA duplex using OLIGOFECTAMINE Reagent (product number: 12252011 from Life Technologies, now Invitrogen; www.invitrogen.com) and assay for silencing 2 days after transfection. We follow the guidelines for 24-well plate formats described in the 12252011.pdf file. Transfection efficiencies are typically around 90-95%. No silencing is observed in the absence of transfection reagent. Oligofectamine has the advantage of being non-toxic to cells and the medium does not to be changed after transfection. siRNA transfection is also possible by using TransIT-TKO: small interfering RNA (siRNA) Transfection Reagent, which is provided by Mirus. Transit-TKO reagent is more difficult to handle than OLIGOFECTAMINE, because concentrations required for effective transfection also cause cytotoxic effects. Typical side effects of Transit-TKO siRNA transfection are morphologic changes such as formation of extended lamellipodia as well as oval-shaped nuclei, and which appear about 2 days after transfection. These effects are observed using between 4.0 and 4.5 祃 of Transit-TKO reagent. Two other siRNA transfection reagent were recently introduced by Polyplus-transfection SAS, termed jetSI, and by Upstate, termed siIMPORTER. Both of these reagents, we have not yet tested.

For one well of a 24-well plate, we use 0.84 µg siRNA duplex (60 pmole in 3 µl annealing buffer). Mix 3 µl of 20 µM siRNA duplex with 50 µl of Opti-MEM. In another tube, mix 3 µl of OLIGOFECTAMINE Reagent (or 3 to 3.5 µl Transit TKO) with 12 µl of Opti-MEM, incubate 7 to 10 min at room temperature. Combine the solutions and gently mix by inversion. Do not vortex. Incubate another 20 to 25 min at room temperature; the solution turns turbid. Then add 32 µl of fresh Opti-MEM to obtain a final solution volume of 100 µl. (The addition of 32 µl Opti-MEM is optional and serves only to adjust the total volume of cell culture medium to 600 µl after transfection.) Add the 100 µl of siRNA-OLIGOFECTAMINE to cultured cells (40 to 50% confluent). The cells were seeded the previous day in 24-well plates using 500 µl of DMEM tissue culture medium supplemented with 10% FBS but without antibiotics.

Transfection of 0.84 µg single-stranded sense siRNA has no effect and 0.84 µg antisense siRNA has a weak silencing effect when compared to 0.84 µg of duplex siRNAs. However, when the siRNA concentrations were reduced 100-fold no antisense effect is apparent while the siRNA duplex is still efficiently silencing. On this note, it is often possible to reduce the siRNA duplex concentration in order to save precious RNA.

The efficiency of transfection may depend on the cell type, but also on the passage number and the confluency of the cells. The time and the manner of formation of siRNA-liposome complexes (e.g. inversion versus vortexing) are also critical. Please follow the instructions provided by the manufacturers or above. Low transfection efficiencies are the most frequent cause of unsuccessful silencing. Good transfection is a non-trivial issue and needs to be carefully examined for each new cell line to be used. To control for transfection, we recommend to target lamin A/C and to determine the fraction of lamin A/C knockdown cells by immunofluorescence. Lamin A/C monoclonal antibodies may be obtained from Santa Cruz Biotechnology (www.scbt.com, product number sc-7292), or from Upstate (www.upstate.com, product number 05-714). Please note, that not all cell lines contain lamin A/C, because its expression is only turned on during organogenesis. I have heard reports that lamin A/C is not expressed in some lines of HEK cells. Alternatively, a feeling for transfection efficiency may be developed by transfection of a CMV-driven EGFP-expression plasmid (e.g. from Clontech) using Lipofectamine 2000 (Invitrogen). The transfection efficiency is then assessed by phase contrast and fluorescence microscopy the next day.

What about other transfection reagents? There are amazing differences in the efficiency of the cationic liposome reagents available on the market. Old, classical reagents are normally bad and only kept in the program of manufacturers to satisfy "conservative" customers, e.g. Lipofectamine 2000 is about 10 times more efficient than the still distributed Lipofectamine. We are just testing different transfection reagents.

Depending on the abundance and the life time (or turnover) of the targeted protein, a knock-down phenotype may become apparent after 1 to 3 days, or even later. In cases where no phenotype is observed, depletion of the protein may be observed by immunofluorescence or Western blotting. If the protein is still abundant after 3 days, cells need to be split and transferred to a fresh 24-well plate for re-transfection. In the case of the lamin A/C knock-down (lamin A/C is not essential), we monitored silencing after 44 hours, but the knock-down of lamin A/C persisted for more than 105 hours (6 generation times), and the protein levels returned to normal levels only after 170 hours incubation (10 generation times). This indicates that replication of siRNA duplexes may not occur in mammalian cells. It also appears that silencing does not spread to neighboring, non-transfected cells.

If no knock-down of the targeted protein is observed, it may be desirable to analyze whether the target mRNA was effectively destroyed by the transfected siRNA duplex. Two days after transfection, total RNA is prepared, reverse transcribed using a target-specific primer, and PCR-amplified with a primer pair covering at least one exon-exon junction in order to control for amplification of pre-mRNAs. RT/PCR of a non-targeted mRNA is also needed as control. Effective depletion of the mRNA yet undetectable reduction of target protein may indicate that a large reservoir of stable protein may exist in the cell. Multiple transfection in sufficiently long intervals may be necessary until the target protein is finally depleted to a point where a phenotype may become apparent.

If multiple transfection steps are required, we recommend splitting cells 2 to 3 days after transfection. The cells may be transfected immediately after splitting. Please note that cells diluted to a confluency of less than 30% may become less effectively transfected.

Finally, what should you do if you cannot detect a knock-down of the targeted mRNA or protein? Confirm that the cell line you are working with is indeed from the species or type you think it is; 36% of cell lines are of different origin or species to that claimed (Masters et al. 2001). Test a different siRNA duplex, sequencing errors in the deposited sequence files, or polymorphisms may be a problem for a given sequence.

Sequences of siRNA duplexes used in our studies

The sequences of siRNA duplexes described in the Nature paper (Elbashir et al. 2001a):

Lamin A/C
targeted region (cDNA): 5' AACTGGACTTCCAGAAGAACATC
sense siRNA: 5' CUGGACUUCCAGAAGAACAdTdT
antisense siRNA: 5' UGUUCUUCUGGAAGUCCAGdTdT


Vimentin
targeted region (cDNA): 5' AACTACATCGACAAGGTGCGCTT
sense siRNA: 5' CUACAUCGACAAGGUGCGCdTdT
antisense siRNA: 5' GCGCACCUUGUCGAUGUAGdTdT


NuMA
targeted region (cDNA): 5' AAGGCGTGGCAGGAGAAGTTCTT
sense siRNA: 5' GGCGUGGCAGGAGAAGUUCdTdT
antisense siRNA: 5' GAACUUCUCCUGCCACGCCdTdT


Lamin B1
targeted region (cDNA): 5' AACGCGCTTGGTAGAGGTGGATT
sense siRNA: 5' CGCGCUUGGUAGAGGUGGAdTdT
antisense siRNA: 5' UCCACCUCUACCAAGCGCGdTdT


GL2 Luciferase
targeted region (cDNA): 5' AACGTACGCGGAATACTTCGATT
sense siRNA: 5' CGUACGCGGAAUACUUCGAdTdT
antisense siRNA: 5' UCGAAGUAUUCCGCGUACGdTdT

SV40-T more effective siRNA (Harborth et al. 2001)
targeted region (cDNA): 5' AAAATTGTGTACCTTTAGCTTTT
sense siRNA: 5' AAUUGUGUACCUUUAGCUUdTdT
antisense siRNA: 5' AAGCUAAAGGUACACAAUUdTdT


References

S. M. Elbashir, J. Harborth, W. Lendeckel, A. Yalcin, Klaus Weber, T. Tuschl (2001a). Duplexes of 21-nucleotide RNAs mediate RNA interference in mammalian cell culture. Nature 411: 494-498.
S. M. Elbashir, W. Lendeckel, T. Tuschl (2001b). RNA interference is mediated by 21 and 22 nt RNAs. Genes & Dev. 15: 188-200.
S. M. Elbashir, J. Martinez, A. Patkaniowska, W. Lendeckel, T. Tuschl (2001c). Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J. 20: 6877-6888.
Q. Ge, M. T. McManus, T. Nguyen, C. H. Shen, P. A. Sharp, H. N. Eisen, J. Chen (2003). RNA interference of influenza virus production by directly targeting mRNA for degradation and indirectly inhibiting all viral RNA transcription. Proc. Natl. Acad. Sci. U. S. A. 100: 2718-23.
J. Harborth, S. M. Elbashir, K. Bechert, T. Tuschl, Klaus Weber (2001). Identification of essential genes in cultured mammalian cells using small interfering RNAs. J. Cell Science 114: 4557-4565.
J. Harborth, S. M. Elbashir, K. Vandenburgh, H. Manninga, S. A. Scaringe, K. Weber and T. Tuschl (2003). Sequence, chemical, and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene silencing, Antisense Nucleic Acid Drug Dev. 13: 83-106.
A. Khvorova, A. Reynolds, S. D. Jayasena, Functional siRNAs and miRNAs exhibit strand bias, Cell 115: 209-216.
J. R. Masters, et al. (2001). Short tandem repeat profiling provides an international reference standard for human cell lines. Proc. Natl. Acad. Sci. USA 98: 8012-8017.
T. Tuschl, P. D. Zamore, R. Lehmann, D. P. Bartel, P. A. Sharp (1999). Targeted mRNA degradation by double-stranded RNA in vitro. Genes & Dev. 13: 3191-3197.
D. S. Schwarz, G. Hutvagner, T. Du, Z. Xu, N. Aronin, P. D. Zamore (2003). Asymmetry in the assembly of the RNAi enzyme complex, Cell 115: 199-208.


Good luck, and we are sure you will be amazed how easy it will be to knock-down your favorite mammalian gene.

Best regards

Tom Tuschl, Sayda Elbashir, Jens Harborth, and Klaus Weber
最新评论共有 0 位网友发表了评论
发表评论
评论内容:请自觉遵守互联网相关政策法规,评论不得超过250字。
用户名: 密码:
匿名?
注册